Database reference: EBOLAID061

Type of target: Loop-Mediated Isothermal Amplification Primers

Techniques: Reverse transcription-loop-mediated isothermal ampli?cation

Target: Primer forward

Original name: F3

Target length: 20

Amplicon length:

Sequence (5-3): GACGGGAGTGAGTGTCTACC

Position in reference genome: 6387-6406

Genomic region: GP

Sequence in reference genome: GACGGGAGUGAGUGUCUACC

Related image:

Related publication:
Molecular Diagnostic Field Test for Point-of-Care Detection of Ebola Virus Directly From Blood.
Benzine J.W.; et al.