Database reference: EBOLAID061
Type of target: Loop-Mediated Isothermal Amplification Primers
Techniques: Reverse transcription-loop-mediated isothermal ampli?cation
Target: Primer forward
Original name: F3
Target length: 20
Amplicon length: Sequence (5-3): GACGGGAGTGAGTGTCTACC
Position in reference genome: 6387-6406 | Genomic region: GP
Sequence in reference genome: GACGGGAGUGAGUGUCUACC
Related image: Related publication: Molecular Diagnostic Field Test for Point-of-Care Detection of Ebola Virus Directly From Blood.Benzine J.W.; et al.