Database reference: EBOLAID057

Type of target: Probe

Techniques: High-throughput RNA extraction/quantitative RT-PCR

Target: Probe (FAM & BlackHole Quencher)

Original name: ZEBOV-P

Target length: 27

Amplicon length:

Sequence (5-3): CATGCCGGAAGAGGAGACAACTGAAGC

Position in reference genome: 877-903

Genomic region: NP

Sequence in reference genome: CAUGCCGGAAGAGGAGACAACUGAAGC

Related image:

Related publication:
High-throughput molecular detection of hemorrhagic fever virus threats with applications for outbreak settings.
Towner, Jonathan S.; et al.

Development of a TaqMan Array Card for Acute-Febrile-Illness Outbreak Investigation and Surveillance of Emerging Pathogens, Including Ebola Virus.
Liu J.; et al.