Database reference: EBOLAID051

Type of target: PCR primer pair

Techniques: Reverse transcription PCR

Target: PCR primer forward

Original name: PanFilo-L3

Target length: 28

Amplicon length: 285


Position in reference genome: 13336-13363

Genomic region: L

Sequence in reference genome: GCUAAAGCAUUUCCUAGCAAUAUGAUGG

Related image:

Related publication:
Emergence of divergent Zaire ebola virus strains in Democratic Republic of the Congo in 2007 and 2008.
Grard, Gilda; et al.