Database reference: EBOLAID037

Type of target: PCR primer pair

Techniques: Reverse transcription PCR

Target: PCR primer forward

Original name: FiloA2.2

Target length: 25

Amplicon length:


Position in reference genome: 13340-13364

Genomic region: L

Sequence in reference genome: AAGCAUUUCCUAGCAAUAUGAUGGU

Related image:

Related publication:
Diagnostic reverse-transcription polymerase chain reaction kit for filoviruses based on the strain collections of all European biosafety level 4 laboratories.
Panning, Marcus; et al.