Database reference: EBOLAID030
Type of target: RT-tHDA primer pair
Techniques: Isothermal reverse transcription-thermophilic helicase-dependent amplification (RT-tHDA)
Target: Primer reverse
Original name: evF3
Target length: 26
Amplicon length: 105
Sequence (5-3): TTCAAAAGTCGGGCGAAAGGAGCATA
Position in reference genome:
Genomic region: NP
Sequence in reference genome: UAUGCUCCUUUCGCCCGACUUUUGAA
Related image:
Related publication:
Development of a novel one-tube isothermal reverse transcription thermophilic helicase-dependent amplification platform for rapid RNA detection.
Goldmeyer, James; Huimin Kong; and Wen Tang.