• Home»
  • Ebola»
  • Reference genome»
  • Alignments»
  • Oligonucleotides»
  • Search»
  • Genome variation»
  • Content»
  • Citation»
  • Contacts»


Database reference: EBOLAID017

Type of target: PCR primer pair

Techniques: Reverse transcription PCR

Target: PCR primer reverse

Original name: FILO-B

Target length: 30

Amplicon length: 419

Sequence (5-3): ATGTGGTGGGTTATAATAATCACTGACATG

Position in reference genome: 13603-13632

Genomic region: L

Sequence in reference genome: CAUGUCAGUGAUUAUUAUAAUCCACCACAU

Related image:



Related publication:
Detection and molecular characterization of Ebola viruses causing disease in human and nonhuman primates.
Sanchez, Anthony; et al.

Identification of Ebola virus sequences present as RNA or DNA in organs of terrestrial small mammals of the Central African Republic.
Morvan, Jacques M.; et al.

Development and evaluation of a fluorogenic 5' nuclease assay to detect and differentiate between Ebola virus subtypes Zaire and Sudan.
Gibb, Tammy R.; et al.

Rapid detection and quantification of RNA of Ebola and Marburg viruses, Lassa virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, dengue virus, and yellow fever virus by real-time reverse transcription-PCR.
Drosten, Christian; et al.

Diagnostic reverse-transcription polymerase chain reaction kit for filoviruses based on the strain collections of all European biosafety level 4 laboratories.
Panning, Marcus; et al.



Back to top

EbolaID: A database of informative genomic regions for virus identification