Database reference: EBOLAID017
Type of target: PCR primer pair
Techniques: Reverse transcription PCR
Target: PCR primer reverse
Original name: FILO-B
Target length: 30
Amplicon length: 419
Sequence (5-3): ATGTGGTGGGTTATAATAATCACTGACATG
Position in reference genome: 13603-13632 | Genomic region: L
Sequence in reference genome: CAUGUCAGUGAUUAUUAUAAUCCACCACAU
Related image: Related publication: Detection and molecular characterization of Ebola viruses causing disease in human and nonhuman primates.Sanchez, Anthony; et al.
Identification of Ebola virus sequences present as RNA or DNA in organs of terrestrial small mammals of the Central African Republic.Morvan, Jacques M.; et al.
Development and evaluation of a fluorogenic 5' nuclease assay to detect and differentiate between Ebola virus subtypes Zaire and Sudan.Gibb, Tammy R.; et al.
Rapid detection and quantification of RNA of Ebola and Marburg viruses, Lassa virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, dengue virus, and yellow fever virus by real-time reverse transcription-PCR.Drosten, Christian; et al.
Diagnostic reverse-transcription polymerase chain reaction kit for filoviruses based on the strain collections of all European biosafety level 4 laboratories.Panning, Marcus; et al.