Database reference: EBOLAID005
Type of target: PCR primer pair
Techniques: Reverse transcription PCR and nested PCR
Target: PCR primer forward
Original name: GAB-1
Target length: 21
Amplicon length: 353
Sequence (5-3): GAATGTAGGTAGAACCTTCGG
Position in reference genome:
Genomic region: L
Sequence in reference genome: GAAUGUAGGUAGAACCUUCGG
Related image:
Related publication:
Identification of Ebola virus sequences present as RNA or DNA in organs of terrestrial small mammals of the Central African Republic.
Morvan, Jacques M.; et al.