Database reference: EBOLAID002
Type of target: PCR primer pair
Techniques: Reverse transcriptase PCR and nested PCR
Target: PCR primer reverse
Original name: EBO-2
Target length: 20
Amplicon length: 479
Sequence (5-3): ACGACACCTTCAGCRAAAGT
Position in reference genome:
Genomic region: GP
Sequence in reference genome: ACUUUCGCUGAAGGUGUCGU
Related image:
Related publication:
Identification of Ebola virus sequences present as RNA or DNA in organs of terrestrial small mammals of the Central African Republic.
Morvan, Jacques M.; et al.