Database reference: EBOLAID075

Type of target: Loop-Mediated Isothermal Amplification Primers

Techniques: Reverse transcription-loop-mediated isothermal ampli?cation

Target: Primer forward

Original name: EBOV-LB

Target length: 26

Amplicon length:

Sequence (5-3): ATAATACACCCGTGTATAAACTTGAC

Position in reference genome: 7203-7228

Genomic region: GP

Sequence in reference genome: AUAAUACACCCGUGUAUAAACUUGAC

Related image:

Related publication:
Visual detection of Ebola virus using reverse transcription loop-mediated isothermal amplification combined with nucleic acid strip detection.
Xu C.; et al.