Database reference: EBOLAID073

Type of target: Loop-Mediated Isothermal Amplification Primers

Techniques: Reverse transcription-loop-mediated isothermal ampli?cation

Target: Primer reverse

Original name: EBOV-B3

Target length: 20

Amplicon length:

Sequence (5-3): TGTCTGCTCTACGGTGATGT

Position in reference genome: 7255-7274

Genomic region: GP

Sequence in reference genome: ACAUCACCGCAGAACAGACA

Related image:

Related publication:
Visual detection of Ebola virus using reverse transcription loop-mediated isothermal amplification combined with nucleic acid strip detection.
Xu C.; et al.