Database reference: EBOLAID065

Type of target: Loop-Mediated Isothermal Amplification Primers

Techniques: Reverse transcription-loop-mediated isothermal ampli?cation

Target: Primer forward

Original name: F3

Target length: 23

Amplicon length:

Sequence (5-3): CAATAAACAACTATTTAAATAAC

Position in reference genome: 18321-18343

Genomic region: 3'UTR

Sequence in reference genome: CAAUAAACAACUAUUUAAAUAAC

Related image:

Related publication:
Development and Evaluation of Reverse Transcription-Loop-Mediated Isothermal Amplification (RT-LAMP) Assay Coupled with a Portable Device for Rapid Diagnosis of Ebola Virus Disease in Guinea.
Kurosaki Y.; et al.