Database reference: EBOLAID023

Type of target: PCR primer pair

Techniques: Reverse transcription PCR

Target: PCR primer forward

Original name: SudZaiNP1(+)

Target length: 20

Amplicon length: 187

Sequence (5-3): GAGACAACGGAAGCTAATGC

Position in reference genome: 890-909

Genomic region: NP

Sequence in reference genome: GAGACAACUGAAGCUAAUGC

Related image:



Related publication:
Rapid diagnosis of Ebola hemorrhagic fever by reverse transcription-PCR in an outbreak setting and assessment of patient viral load as a predictor of outcome.
Towner, Jonathan S.; et al.