Database reference: EBOLAID007

Type of target: PCR primer pair

Techniques: Reverse transcription PCR

Target: PCR primer forward

Original name: EBO-BP1

Target length: 24

Amplicon length: 579

Sequence (5-3): AATGGGCTGAAAATTGCTACAATC

Position in reference genome: 6346-6369

Genomic region: GP

Sequence in reference genome: AAUGGGCUGAAAACUGCUACAAUC

Related image:

Related publication:
Detection and molecular characterization of Ebola viruses causing disease in human and nonhuman primates.
Sanchez, Anthony; et al.