Database reference: EBOLAID068

Type of target: Loop-Mediated Isothermal Amplification Primers

Techniques: Reverse transcription-loop-mediated isothermal ampli?cation

Target: Primer forward

Original name: F3

Target length: 21

Amplicon length:

Sequence (5-3): TGAAGTCAAGAAGCGTGATGG

Position in reference genome: 787-807

Genomic region: NP

Sequence in reference genome: UGAAGUCAAGAAGCGUGAUGG

Related image:

Related publication:
Development and Evaluation of Reverse Transcription-Loop-Mediated Isothermal Amplification (RT-LAMP) Assay Coupled with a Portable Device for Rapid Diagnosis of Ebola Virus Disease in Guinea.
Kurosaki Y.; et al.