Database reference: EBOLAID056

Type of target: PCR primer pair

Techniques: High-throughput RNA extraction/quantitative RT-PCR

Target: PCR primer reverse

Original name: ZEBOV-R

Target length: 21

Amplicon length: 80

Sequence (5-3): AGGAGAGAAACTGACCGGCAT

Position in reference genome: 906-926

Genomic region: NP

Sequence in reference genome: AUGCCGGUCAGUUUCUCUCCU

Related image:

Related publication:
High-throughput molecular detection of hemorrhagic fever virus threats with applications for outbreak settings.
Towner, Jonathan S.; et al.

Development of a TaqMan Array Card for Acute-Febrile-Illness Outbreak Investigation and Surveillance of Emerging Pathogens, Including Ebola Virus.
Liu J.; et al.