Database reference: EBOLAID028

Type of target: PCR primer pair

Techniques: SYBR Green real time PCR

Target: PCR primer reverse

Original name: EBsp3

Target length: 22

Amplicon length: 277


Position in reference genome: 13600-13621

Genomic region: L

Sequence in reference genome: AUGCAUGUCAGUGAUUAUUAUA

Related image:

Related publication:
Detection of Ebola virus in oral fluid specimens during outbreaks of Ebola virus hemorrhagic fever in the Republic of Congo.
Formenty, P.; Leroy, E. M.; Epelboin, A.; Libama, F.; Lenzi, M.; Sudeck, H.; ... & Roth, C.

Laboratory diagnosis of Ebola and Marburg hemorrhagic fever.
Grolla, A.; Lucht, A.; Dick, D.; Strong, J. E.; & Feldmann, H.