Database reference: EBOLAID016
Type of target: PCR primer pair
Techniques: Reverse transcription PCR
Target: PCR primer forward
Original name: FILO-A
Target length: 22
Amplicon length: 419
Sequence (5-3): ATCGGAATTTTTCTTTCTCATT
Position in reference genome:
Genomic region: L
Sequence in reference genome: AUCGGAACUUUUCUUUCUCAUU
Related image:
Related publication:
Detection and molecular characterization of Ebola viruses causing disease in human and nonhuman primates.
Sanchez, Anthony; et al.
Identification of Ebola virus sequences present as RNA or DNA in organs of terrestrial small mammals of the Central African Republic.
Morvan, Jacques M.; et al.
Development and evaluation of a fluorogenic 5' nuclease assay to detect and differentiate between Ebola virus subtypes Zaire and Sudan.
Gibb, Tammy R.; et al.
Rapid detection and quantification of RNA of Ebola and Marburg viruses, Lassa virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, dengue virus, and yellow fever virus by real-time reverse transcription-PCR.
Drosten, Christian; et al.