Database reference: EBOLAID010

Type of target: PCR primer pair

Techniques: Reverse transcription PCR

Target: PCR primer reverse

Original name: ZAI-NP2

Target length: 26

Amplicon length: 268

Sequence (5-3): GCATATTGTTGGAGTTGCTTCTCAGC

Position in reference genome: 1517-1542

Genomic region: NP

Sequence in reference genome: GCUGAGAAGCAACUCCAACAAUAUGC

Related image:

Related publication:
Detection and molecular characterization of Ebola viruses causing disease in human and nonhuman primates.
Sanchez, Anthony; et al.